Huff, Huff, Huff...

He used several powerful witchcrafts in succession. Without the blessing of the perpetual motion machine of the magic wand of the truth balance, even Green did not breathe slightly, and constantly used the rules of the witch ancestor to convert the power of the surrounding void into elements, sucked into his body, and replenished the loss.

The City of Abyss was bombarded with a diameter of kilometers by Green's sky-based star destroyer. The metal inside had completely melted into liquid and penetrated from the other side of the City of Abyss.

The metal near the cave was as red as iron, and the sound of "squeaking" and "squeaking" energy burst out.

Despite this, for this metal fortress, which is too large, it is not fatal to have a single blow to penetrate the core power chamber with a single blow of the space-based star destroyer.

Except for the Abyss Demon Dragon King who was launching the abyss summoning technique in the distance, pounced on Green all the abyss demon dragons it could affect towards Green, the other three demon ancestors had already stood in a row.

Crackling!

With a black arc, the target pointed directly at the Abyss Demon Dragon King, but saw the afterimage of the Demon Ancestor's ring flashing in front of the arc of destruction. He opened his chest and swallowed the arc of destruction in one mouthful. Then he "gulu" in his abdomen. After struggling for a while, he burped and digested the arc of destruction?

This demon ancestor is indeed extraordinary.

The endless group of magic dragons behind were still attacking, and Green was really tired of it. After taking a deep breath, the magic elements in his body gathered towards Green's right hand.

"The secret of truth, dimension dimension, dimension gap sealing technique!"

Green suddenly used his own talent and communication dimensions, and only such witchcraft rules could limit such a large-scale legion.

With Green's right hand slashing hard, with a "click", nothing in front of him was cut by Green, and the dark hole opened and spread a million meters away. Although there was no assistance from the forgetful world memory of the Book of Truth, Green's long time was enough to independently support the dimensional gap sealing technique. As for the chaotic memories in time, it doesn't matter if it is abandoned.

"At the cost of memory, open up the space of imagination, communicate with those gaps in the dimensions of thinking gathering, and are closest to the power of creatures at higher latitudes."

Green seemed to be muttering to himself.

As Green cut open this dark crack, the illusory space-time power of chaotic imagination spreads out in an instant. In this world of thinking layer between different dimensions, no matter how strong the creature below the dominance will be affected by the rules, becoming a slave under the rules of imagination, and being dominated by the endless unknown creatures of imagination.

Sure enough, as the dimensional gap imagination rules spread, no matter how many groups of abyss demon dragons that are close to the scope of the rules, they are just a grain of sand in the desert, which is insignificant and turn into stones.

Each stone is only about meter, shiny, falling on the metal deck of the Abyss City, it cannot move.

In this scene, even the abyss demon ancestors were completely stunned.

Queches Queches Queches Queches Queches Queches Queches...

An astonishing number of black crows flew out from the black cracks. Each dimension had hundreds of meters of crows, with white eyes and no pupils. When these crows saw the stones on the ground, they screamed excitedly.

"Quaguaguaguaguaguagua, hurry up, there are stones there. As long as we put them in the bottle, we will have water to drink!"

"There are so many stones, just too small, we don't know when we will pick them up!"

More and more crows flew out from the cracks in the dimension gap, which seemed to represent that the dimensional gap rules had an increasingly stronger impact on this space-time. Flowers and plants grew on the metal deck of the Abyss City, and stones were scattered among the flowers and plants, looking very harmonious and natural.

Amid the cry of "quack quack quack", the stones turned into by the abyss demon dragon were brought into the dimension gap one by one by the crows. Even if there are many abyss demon dragons approaching, they only provide higher stones for these crows.

He had never tear open such a huge gap and crack in the gap in dimension, and Green's tired look was unconcealed.

At the other end of the crack, there were things like Xiao Ba, and there were thousands of strange and unexplainable, chaotic and strange things, like broken glass mirror curtains.

Just when Green breathed a little relieved, because he was too tired to touch the elemental body, he reappeared with his mental power to look at the demons. Suddenly, a mutation occurred!

"Walkers on the journey, pick up a few more stones, which will be useful."

The illusory words came from the other end of the crack, and a voice asked, "Who are you?"

However, no one answered.

Green's steps towards the three masters gradually stopped, and seemed to have discovered something extremely incredible, something that Green as a level nine creature now is difficult to understand.

Sudden!

Not only those abyss demon dragons, but also several abyss demon ancestors, the surrounding abyss fortresses, and even the entire abyss city are turning into stones little by little!

Several demon ancestors struggled, roared, and even used the omnipotent soul, but it was still useless. They expanded into true body states and turned into huge rocks tens of thousands of meters.

The light of the mental power of Green's body is uncertain. Under the imagination rules of the gap between dimensions, it is also changing. From an invisible body to a stone, but because of the unit nature of the witch's ancestor's rule, the stone is turned into a light of mental power. The stalemate between the two cannot be stopped.

The demon ancestors have all turned into stones. Even if they use the universal soul to change the facts, they are just stones with two hands, stones with two legs, and stones with two feet. After a short moment, they turn into stones again.

"What the hell is going on!"

Green couldn't understand these dimensional gap sealing techniques that were beyond his control, and seemed to have returned to his wizard apprenticeship. He believed that he had mastered the secrets of truth, but in the end he found that he had just completed enlightenment.

"All right."

With the sound of suspicion at the other end of the crack, as a super big hand of hundreds of thousands of meters slowly stretched out from the other end of the crack, the crows seemed to be unaware of it, and passed through the big hand. Green did not care about anything else and hurriedly escaped from this space and time at full speed. However, after this big hand grabbed a handful of a small stone of the Abyss Demon Dragon, it seemed to be just sand to him, and then he scattered it away. Then he grabbed the stones of the Abyss Fortress and the Demon Ancestor Without Abyss.

Of course, even for this big hand that is hundreds of thousands of meters tall, the stone of the Abyss City is too huge. After exploring for a while, he took back his palm.

"Even they were taken away!"

The three Abyss Demon Ancestors, one Abyss Demon Dragon King, and several Abyss Fortresses were all captured by that big hand!

At the same time, it seemed that this big hand consumed too much imagination rules, and the cracks between dimensions gradually healed. After the crows took the last stone, they returned one after another.

As the cracks became smaller and smaller, the influence of the dimensional gap rules became weaker and weaker. The abyss demon dragons who turned into stones gradually began to recover their true bodies, but because they lost the dominance of the abyss summoning, except for a small part nearby who continued to entangle Green, the others were in a state of chaos.

Even Green's true body of the way of extinction was captured!

"Ah! It turned out to be a gem! Damn, I didn't catch a few more, and there was that huge gem, ah!"
Chapter completed!